0

3 c r hammond 2000   the elements in handbook of chemistry and physics 81st edition

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Báo cáo khoa học

... supplier, and by using the primer pair 5¢GGCACCTCTTGGGCCGCCGCAGGC -3 and 5¢-GCC TGCGGCGGCCCAAGAGGTGCC -3 for the H67A mutant, by using the primer pair 5¢-GCAGCGGCAC CTCTTCTCACGCCGCAGGCTTG -3 and ... 5¢-CAAG CCTGCGGCGTGAGAAGAGGTGCCGCTGC -3 for the W66S mutant, and by using the primer pair 5¢-GCCACCTCTTTCCACGCCGCAGGC -3 and 5¢-GC CTGCGGCGTGGAAAGAGGTGCC -3 for the W66F mutant Spectroscopic measurements ... DNA carrying the sarcosine dehydrogenase-like ORF 63, corresponding to a protein of 8 13 amino acids with a predicted molecular mass of 89 39 5 kDa, was inserted into the expression vector pH6EX3,...
  • 8
  • 647
  • 0
Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

Báo cáo khoa học

... transfer reactions, proton transfer occurs during the reduction of the binuclear center and during the reduction of oxygen from the peroxy to the oxyferryl intermediates [17] A water cycle during ... in earlier work [18] The data were collected at 250 K in the presence of low concentrations of cytochrome c plus TMPD and ascorbate As the concentration of cytochrome c is increased, the fraction ... Volume cycles for electron transfer in 21 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 the cytochrome c oxidase and for the binding of cytochrome c to cytochrome c oxidase Biophys J 75, 435 –444...
  • 8
  • 343
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Imperfect DNA mirror repeats in the gag gene of HIV-1 (HXB2) identify key functional domains and coincide with protein structural elements in each of the mature proteins" doc

Hóa học - Dầu khí

... and CA-H4 helices CypA interaction; surface of virion core CypA interaction; surface of virion core CA H9 helix, endocytosis signal interacts with LysRS necessary for formation of dimer interface ... and protein The interaction between DNA and protein structure and function is precise and interwoven over the entire length of the protein The distribution of mIMRs and rdIMRs and their relationship ... are generally shorter than and often contained within mIMRs Lang [1] found statistically significant correlations for the coincidence of the ends of rdIMRs and the ends of protein structural elements...
  • 13
  • 538
  • 0
the enforcement of intellectual property rights with foreign elements in vietnam of people’s public security in current period

the enforcement of intellectual property rights with foreign elements in vietnam of people’s public security in current period

Tiến sĩ

... forces Research object and scope of the thesis Regarding research object: The thesis studies some theoretical and practical issues of the enforcement of intellectual property rights with foreign ... general issues of intellectual property rights and intellectual property rights enforcement, continue to research to introduce the definition and characteristics of the enforcement of intellectual ... foreign elements in Vietnam of people’s public security force Regarding research scope: - Carry out research on activities of the people’s public security force in the enforcement of intellectual property...
  • 28
  • 271
  • 0
THE ENFORCEMENT OF INTELLECTUAL PROPERTY RIGHTS WITH FOREIGN ELEMENTS IN VIETNAM OF PEOPLE’S PUBLIC SECURITY IN CURRENT PERIOD

THE ENFORCEMENT OF INTELLECTUAL PROPERTY RIGHTS WITH FOREIGN ELEMENTS IN VIETNAM OF PEOPLE’S PUBLIC SECURITY IN CURRENT PERIOD

Luận văn báo cáo - ngoại ngữ

... producing crime, trafficking in counterfeit goods and control the export and import of goods across the border, etc 3. 2 .3. 2 Shortcomings in the enforcement of intellectual property rights having ... period" for the doctoral thesis in order to meet theoretical and practical requirements Purposes and duties of research With regard to the research purposes, the thesis clarifies the theoretical ... intellectual property According to nature and characteristics of each object of intellectual property, contents of property rights of intellectual property right holders are differently stintellectual...
  • 28
  • 324
  • 0
Báo cáo y học:

Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"

Y khoa - Dược

... retrospective manner from the general archives of clinical histories, always respecting the inclusion criteria (period 2000- 2004), and the new controls were gathered in a prospective manner in the Internal ... of clinical prognostic factors for survival and time to progression in patient with metastatic colorectal cancer treated with 5-fluoroucil-based chemotherapy Clin Colorrectal Cancer 20 03; 4: 231 - 234 ... which we found acceptable Each health center and each hospital were connected to each other in such a way that the users of the primary care centers were admitted in the tertiary care centers, thereby...
  • 8
  • 559
  • 0
The revolution in philosophy (II) - autonomy and the moral order

The revolution in philosophy (II) - autonomy and the moral order

TOEFL - IELTS - TOEIC

... agent is following in performing the action; actions can always be said to be correct or incorrect, right or wrong Kant characterized the normative principle that the agent is acting on as a “maxim,” ... subjective principle of action that the agent follows in her actions, and it is the character of acting according to maxims that expresses our spontaneity in the practical sphere, since an action ... stresses this point in all his writings on moral philosophy, and particularly in both the Critique of Practical Reason and the Groundwork of the Metaphysics of Morals In the Groundwork, Kant claims...
  • 21
  • 399
  • 0
A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

Khoa học xã hội

... me in the course of doing this research However, due to the lack of time I cannot present them all - Further research should focus on many other songs in the treasure of Trinh Cong Son with more ... by Baker, Newmark and Catford 3. 5 RESEARCH PROCEDURES For the research to be carried out properly, the steps below will be taken: - Collecting lexicon (words and phrases) and sentences from 14 ... to find out the semantic features of lexicon and syntactic features of phrases and sentences on the basis of translation theory 3. 3 METHOD OF RESEARCH This research paper is carried out with the...
  • 13
  • 708
  • 1
Tài liệu The World in 2011 ICT Facts and Figures pdf

Tài liệu The World in 2011 ICT Facts and Figures pdf

Quản trị mạng

... leverage mobile-broadband technologies to overcome infrastructure barriers and provide high-speed Internet services to previously unconnected areas In Africa, mobile-broadband penetration has reached ... (wired)-broadband subscriptions †† June 2010 data Source: ITU World Telecommunication/ICT Indicators database 100% The World in 2011 — ICT Facts and Figures Fixed broadband prices in developing countries ... in Europe, compared with 2’000 bit/s per user in Africa 87 39 5 International Internet bandwidth (bit/s) per Internet user, 2011* International Internet bandwidth (bit/s) per Internet user, 2011*...
  • 8
  • 504
  • 0
Tài liệu The Law (In Plain English)® for and Others inn the Food Idustry ppt

Tài liệu The Law (In Plain English)® for and Others inn the Food Idustry ppt

Cao đẳng - Đại học

... existence to be specified in the articles of incorporation (or other corporate formation documents) Shareholders, unlike partners, cannot decide to withdraw and demand a return of capital from the corporation ... full participation in the control of the corporation through the shareholder’s voting privileges The higher the percentage of outstanding shares owned, the more significant the control For the small ... each partner Since no formalities are required to create a partnership, if the partners not have a formal agreement defining the terms of the partnership, such as control of the partnership or...
  • 306
  • 1,711
  • 1
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

Báo cáo khoa học

... which indicated a homotetrameric structure in solution Therefore, on the basis of its quaternary structure, SsCU-NH is a member of the tetrameric group of NHs together with the structurally characterized ... Hyperthermophilic Archaea are of extreme interest for understanding the molecular mechanisms of structural and functional adaptation of proteins to extreme temperatures and also for the peculiar ... hyperthermophilic enzymes acquire their unusual thermostability and to increase our knowledge on the structure of NHs, we carried out the expression, purication and physicochemical characterization...
  • 15
  • 557
  • 0
Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

Báo cáo khoa học

... gcctccaagacgta -3 and 5¢-gaattcttattcctcctctggccaaa -3 The PCR product was cloned, similar to gld1, first in a TOPO vector and then in the expression vector p2159 The S cerevisiae strain CEN.PK2-1B ... procedures Cloning and expression of the open reading frames for gld1 and gld2 The gld1 gene was cloned from a cDNA library of the H jecorina strain Rut C -30 [21] by PCR The following primers, ... primers, introducing an EcoRI restriction site, were used: 5¢-gaattcaacatgtcttccggaaggac -3 and 5¢-gaattcttacagcttgatga cagcag -3 The PCR product was cloned in a TOPO vector FEBS Journal 2 73 (2006)...
  • 7
  • 510
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học

... Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT -3 ), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG -3 ), and cloned in pPROTET and pEGFP plasmids using methods essentially described previously ... and the C- terminal pDED region (amino acids 33 5–429), were cloned and expressed in bacteria, and the proteins were purified Interactions of the purified 6X(HN)-pDED and the N-terminal domains of ... You CY (2007) The viral death protein Apoptin interacts with Hippi, the protein interactor of Huntingtin-interacting protein Biochem Biophys Res Commun 30 5, 35 9– 36 4 12 Roth W, Kermer P, Krajewska...
  • 14
  • 393
  • 0
The Handbook of Training and Practice in Infant and Preschool Mental Health potx

The Handbook of Training and Practice in Infant and Preschool Mental Health potx

Sức khỏe giới tính

... edited by Andrea Barnes The Handbook of Training and Practice in Infant and Preschool Mental Health Karen Moran Finello, Editor Q The Handbook of Training and Practice in Infant and Preschool Mental ... examination of programs in Illinois and New York that transform training and practice through the infusion of reflective process and the creation of “ripples” across systems As infant and preschool ... considered essential for best practice WORKING RELATIONSHIPS Translating Principles into Practice With these ground rules in place, how trainers or supervisors help trainees reach an understanding of...
  • 529
  • 477
  • 0
Preferences of the Central Reserve Bank of Peru and optimal monetary policy rules in the inflation targeting regime ppt

Preferences of the Central Reserve Bank of Peru and optimal monetary policy rules in the inflation targeting regime ppt

Ngân hàng - Tín dụng

... shown by the nonprimary sector (specifically, the manufacturing and construction sectors), increase in credit lines in the 24 As registered by the Annual Report of CRBP (1999), this larger dynamism ... appropriate when there exists a contemporaneous correlation between the error terms In this case, the 25 During 2007 China became the major purchaser of Peruvian mining products with a 39 % purchasing quota ... Identificación de las Preferencias Del Banco Central en la Aplicación de Política Monetária,1999”.Reserch: macroeconomic politic and Growth , Consortium for Economic and Social Research and Pacific...
  • 37
  • 561
  • 0
Casual Game Design: Designing Play for the Gamer in ALL of Us

Casual Game Design: Designing Play for the Gamer in ALL of Us

Thiết kế - Đồ họa - Flash

... at the core of the game The rest of the game, from the story to the art, should grow from the core mechanic At the outset of a project, the game designer will brainstorm initial concepts for the ... mechanics, rather than try to address all aspects of the game Your test could ask whether the main interaction—such as sorting cards—is intuitive or whether players feel comfortable clicking and ... from conception through to launch Like the director of a film, the game designer is responsible for creating and maintaining the creative direction of the game, working with the artists, programmers...
  • 253
  • 1,267
  • 0
An analysis on cultural elements in translation of English slogans into Vietnamese

An analysis on cultural elements in translation of English slogans into Vietnamese

Khoa học xã hội

... OF CULTURE With modern technology shrinking our world, international borders are becoming less of a barrier The only thing which is the barrier among the countries is the culture Because of the ... whole and they interact with each other Success in translation is, to a great extent, success in translating these aspects or transferring these cultural messages 1 .3. 3 Western Culture and Eastern ... semantic translating where the translator attempts, within the base syntactic and semantic constraints of the target language, to reproduce the precise contextual meaning of the author” Therefore, the...
  • 43
  • 1,088
  • 4
Báo cáo

Báo cáo " The dependence of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices on concentration of impurities" pot

Báo cáo khoa học

... Journal of Science, Mathematics - Physics 25 (2009) 1 23- 128 here, nD is concentration of impurities, m and e are the effective mass and the charge of the electron, respectively and en are the ... coefficient of acoustic and optical phonon in doped superlattices In order to establish the parametric transformation coefficient of acoustic and optical phonon, we r use standard Fourier transform ... density, the acoustic velocity and the deformation potential constant, respectively χ is the electronic constant, χ ∞ , χ are the static and high-frequency r dielectric constants, respectively The...
  • 6
  • 375
  • 0
Báo cáo

Báo cáo " Impacts of climate change on the flow in Hong-Thai Binh and Dong Nai river basins " docx

Báo cáo khoa học

... Bu and Vu Quang are 1418m3/s (increasing by 8.71%), 30 41m3/s (increasing by 7.22%) and 1855m3/s (increasing by 6.08%) The calculation flood flow in B2 scenario is smaller And the increases in comparison ... differences of the increase in flow in the scenarios The increase in flood flow in scenario B1 is the highest In the period 2080 - 2099: Flood flow discharge increases quite markedly compared ... and in A2 scenario is the slowest 3. 2 Flood season flow According to three climate change scenarios, there are increasing trends of flood season flow in Hong-Thai Binh basin In general, the increase...
  • 9
  • 515
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose