... supplier, and by using the primer pair 5¢GGCACCTCTTGGGCCGCCGCAGGC -3 and 5¢-GCC TGCGGCGGCCCAAGAGGTGCC -3 for the H67A mutant, by using the primer pair 5¢-GCAGCGGCAC CTCTTCTCACGCCGCAGGCTTG -3 and ... 5¢-CAAG CCTGCGGCGTGAGAAGAGGTGCCGCTGC -3 for the W66S mutant, and by using the primer pair 5¢-GCCACCTCTTTCCACGCCGCAGGC -3 and 5¢-GC CTGCGGCGTGGAAAGAGGTGCC -3 for the W66F mutant Spectroscopic measurements ... DNA carrying the sarcosine dehydrogenase-like ORF 63, corresponding to a protein of 8 13 amino acids with a predicted molecular mass of 89 39 5 kDa, was inserted into the expression vector pH6EX3,...
... transfer reactions, proton transfer occurs during the reduction ofthe binuclear center and during the reduction of oxygen from the peroxy to the oxyferryl intermediates [17] A water cycle during ... in earlier work [18] The data were collected at 250 K inthe presence of low concentrations of cytochrome c plus TMPD and ascorbate As the concentration of cytochrome c is increased, the fraction ... Volume cycles for electron transfer in 21 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 the cytochrome c oxidase and for the binding of cytochrome c to cytochrome c oxidase Biophys J 75, 435 –444...
... and CA-H4 helices CypA interaction; surface of virion core CypA interaction; surface of virion core CA H9 helix, endocytosis signal interacts with LysRS necessary for formation of dimer interface ... and protein The interaction between DNA and protein structure and function is precise and interwoven over the entire length ofthe protein The distribution of mIMRs and rdIMRs and their relationship ... are generally shorter than and often contained within mIMRs Lang [1] found statistically significant correlations for the coincidence ofthe ends of rdIMRs andthe ends of protein structural elements...
... forces Research object and scope ofthe thesis Regarding research object: The thesis studies some theoretical and practical issues ofthe enforcement of intellectual property rights with foreign ... general issues of intellectual property rights and intellectual property rights enforcement, continue to research to introduce the definition and characteristics ofthe enforcement of intellectual ... foreign elementsin Vietnam of people’s public security force Regarding research scope: - Carry out research on activities ofthe people’s public security force inthe enforcement of intellectual property...
... producing crime, trafficking in counterfeit goods and control the export and import of goods across the border, etc 3. 2 .3. 2 Shortcomings inthe enforcement of intellectual property rights having ... period" for the doctoral thesis in order to meet theoretical and practical requirements Purposes and duties of research With regard to the research purposes, the thesis clarifies the theoretical ... intellectual property According to nature and characteristics of each object of intellectual property, contents of property rights of intellectual property right holders are differently stintellectual...
... retrospective manner from the general archives of clinical histories, always respecting the inclusion criteria (period 2000- 2004), andthe new controls were gathered in a prospective manner inthe Internal ... of clinical prognostic factors for survival and time to progression in patient with metastatic colorectal cancer treated with 5-fluoroucil-based chemotherapy Clin Colorrectal Cancer 20 03; 4: 231 - 234 ... which we found acceptable Each health center and each hospital were connected to each other in such a way that the users ofthe primary care centers were admitted inthe tertiary care centers, thereby...
... agent is following in performing the action; actions can always be said to be correct or incorrect, right or wrong Kant characterized the normative principle that the agent is acting on as a “maxim,” ... subjective principle of action that the agent follows in her actions, and it is the character of acting according to maxims that expresses our spontaneity inthe practical sphere, since an action ... stresses this point in all his writings on moral philosophy, and particularly in both the Critique of Practical Reason andthe Groundwork ofthe Metaphysics of Morals Inthe Groundwork, Kant claims...
... me inthe course of doing this research However, due to the lack of time I cannot present them all - Further research should focus on many other songs inthe treasure of Trinh Cong Son with more ... by Baker, Newmark and Catford 3. 5 RESEARCH PROCEDURES For the research to be carried out properly, the steps below will be taken: - Collecting lexicon (words and phrases) and sentences from 14 ... to find out the semantic features of lexicon and syntactic features of phrases and sentences on the basis of translation theory 3.3 METHOD OF RESEARCH This research paper is carried out with the...
... leverage mobile-broadband technologies to overcome infrastructure barriers and provide high-speed Internet services to previously unconnected areas In Africa, mobile-broadband penetration has reached ... (wired)-broadband subscriptions †† June 2010 data Source: ITU World Telecommunication/ICT Indicators database 100% The World in 2011 — ICT Facts and Figures Fixed broadband prices in developing countries ... in Europe, compared with 2’000 bit/s per user in Africa 87 39 5 International Internet bandwidth (bit/s) per Internet user, 2011* International Internet bandwidth (bit/s) per Internet user, 2011*...
... existence to be specified inthe articles of incorporation (or other corporate formation documents) Shareholders, unlike partners, cannot decide to withdraw and demand a return of capital from the corporation ... full participation inthe control ofthe corporation through the shareholder’s voting privileges The higher the percentage of outstanding shares owned, the more significant the control For the small ... each partner Since no formalities are required to create a partnership, if the partners not have a formal agreement defining the terms ofthe partnership, such as control ofthe partnership or...
... which indicated a homotetrameric structure in solution Therefore, on the basis of its quaternary structure, SsCU-NH is a member ofthe tetrameric group of NHs together with the structurally characterized ... Hyperthermophilic Archaea are of extreme interest for understanding the molecular mechanisms of structural and functional adaptation of proteins to extreme temperatures and also for the peculiar ... hyperthermophilic enzymes acquire their unusual thermostability and to increase our knowledge on the structure of NHs, we carried out the expression, purication and physicochemical characterization...
... gcctccaagacgta -3 and 5¢-gaattcttattcctcctctggccaaa -3 The PCR product was cloned, similar to gld1, first in a TOPO vector and then inthe expression vector p2159 The S cerevisiae strain CEN.PK2-1B ... procedures Cloning and expression ofthe open reading frames for gld1 and gld2 The gld1 gene was cloned from a cDNA library ofthe H jecorina strain Rut C -30 [21] by PCR The following primers, ... primers, introducing an EcoRI restriction site, were used: 5¢-gaattcaacatgtcttccggaaggac -3 and 5¢-gaattcttacagcttgatga cagcag -3 The PCR product was cloned in a TOPO vector FEBS Journal 2 73 (2006)...
... Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT -3 ), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG -3 ), and cloned in pPROTET and pEGFP plasmids using methods essentially described previously ... andthe C- terminal pDED region (amino acids 33 5–429), were cloned and expressed in bacteria, andthe proteins were purified Interactions ofthe purified 6X(HN)-pDED andthe N-terminal domains of ... You CY (2007) The viral death protein Apoptin interacts with Hippi, the protein interactor of Huntingtin-interacting protein Biochem Biophys Res Commun 30 5, 35 9– 36 4 12 Roth W, Kermer P, Krajewska...
... edited by Andrea Barnes TheHandbookof Training and Practice in Infant and Preschool Mental Health Karen Moran Finello, Editor Q TheHandbookof Training and Practice in Infant and Preschool Mental ... examination of programs in Illinois and New York that transform training and practice through the infusion of reflective process andthe creation of “ripples” across systems As infant and preschool ... considered essential for best practice WORKING RELATIONSHIPS Translating Principles into Practice With these ground rules in place, how trainers or supervisors help trainees reach an understanding of...
... shown by the nonprimary sector (specifically, the manufacturing and construction sectors), increase in credit lines inthe 24 As registered by the Annual Report of CRBP (1999), this larger dynamism ... appropriate when there exists a contemporaneous correlation between the error terms In this case, the 25 During 2007 China became the major purchaser of Peruvian mining products with a 39 % purchasing quota ... Identificación de las Preferencias Del Banco Central en la Aplicación de Política Monetária,1999”.Reserch: macroeconomic politic and Growth , Consortium for Economic and Social Research and Pacific...
... at the core ofthe game The rest ofthe game, from the story to the art, should grow from the core mechanic At the outset of a project, the game designer will brainstorm initial concepts for the ... mechanics, rather than try to address all aspects ofthe game Your test could ask whether the main interaction—such as sorting cards—is intuitive or whether players feel comfortable clicking and ... from conception through to launch Like the director of a film, the game designer is responsible for creating and maintaining the creative direction ofthe game, working with the artists, programmers...
... OF CULTURE With modern technology shrinking our world, international borders are becoming less of a barrier The only thing which is the barrier among the countries is the culture Because ofthe ... whole and they interact with each other Success in translation is, to a great extent, success in translating these aspects or transferring these cultural messages 1 .3. 3 Western Culture and Eastern ... semantic translating where the translator attempts, within the base syntactic and semantic constraints ofthe target language, to reproduce the precise contextual meaning ofthe author” Therefore, the...
... Journal of Science, Mathematics - Physics 25 (2009) 1 23- 128 here, nD is concentration of impurities, m and e are the effective mass andthe charge ofthe electron, respectively and en are the ... coefficient of acoustic and optical phonon in doped superlattices In order to establish the parametric transformation coefficient of acoustic and optical phonon, we r use standard Fourier transform ... density, the acoustic velocity andthe deformation potential constant, respectively χ is the electronic constant, χ ∞ , χ are the static and high-frequency r dielectric constants, respectively The...
... Bu and Vu Quang are 1418m3/s (increasing by 8.71%), 30 41m3/s (increasing by 7.22%) and 1855m3/s (increasing by 6.08%) The calculation flood flow in B2 scenario is smaller Andthe increases in comparison ... differences ofthe increase in flow inthe scenarios The increase in flood flow in scenario B1 is the highest Inthe period 2080 - 2099: Flood flow discharge increases quite markedly compared ... andin A2 scenario is the slowest 3. 2 Flood season flow According to three climate change scenarios, there are increasing trends of flood season flow in Hong-Thai Binh basin In general, the increase...